✕  Close

1 Introduction

1.1 Background

  • This project uses a longitudinal 16S rRNA amplicon sequencing public data to characterize how the murine gut microbiome changes over time and whether these trajectories differ between male and female mice.
  • Samples were collected repeatedly from the same animals across early and late time windows, enabling within-mouse comparisons while leveraging biological replication across individuals.
  • We will generate amplicon sequence variants (ASVs), assign taxonomy, and quantify both within-sample diversity (alpha diversity) and between-sample community shifts (beta diversity).
  • The primary analysis contrasts early (Day0–25) and late (Day124–175) timepoints, with secondary evaluations of sex effects and sex-by-time interactions to assess whether community maturation patterns are consistent or diverge by sex.

1.2 Aims

  1. Characterize longitudinal community change
    • Quantify early-to-late shifts in microbiome structure using beta diversity and ordination
    • Summarize within-mouse stability versus between-mouse variability across time
  2. Test early vs late differences with replication
    • Compare alpha diversity and community composition between early (Day0–25) and late (Day124–175) time windows
    • Evaluate how robust the early/late signal is across mice (biological replicates)
  3. Assess sex effects on microbiome trajectories
    • Estimate the main effect of sex on community structure and diversity
    • Test for sex-by-time-window interaction (do males and females shift differently from early to late?)

1.3 Materials

Group Male Female Total
Early (Day0–25) 102 91 193
Late (Day124–175) 69 68 137
Total 171 159 330
  • Data source
  • Sequencing format
    • Paired-end Illumina MiSeq FASTQ files generated from 16S rRNA amplicons
    • Filenames encode mouse ID, sex (F/M), and day (e.g., M6D141, F3D8)

1.4 Sample name and color key

  • Nomelclature: [ M (male) | F (female) ][ mouse number ]D[ day ]
  • Examples:
    • M6D141: Male mouse 6 at Day 141
    • F3D8: Female mouse 3 at Day 8
  • Color keys:
    • Sex, N=2: ◼ M (male) and ◼ F (female)
    • Group, N=2: ◼ E (early) and ◼ L (late)

2 Environment

  • OS: macOS 26.2
  • Platform: aarch64-apple-darwin20
  • Software: R, FastQC, MultiQC, cutadapt, VSEARCH
  • R pakcages: dada2 (v1.36.0), Biostrings (v2.76.0), ShortRead (v1.66.0), data.table (v1.18.0), ggplot2 (v4.0.1), patchword (v1.3.2), RColorBrewer (v1.1-3), plotly (v4.11.0)

3 Preprocessing

  • The following workflow was adapted from the DADA2 tutorial and modified as needed to generate this quality analysis report.

3.1 FASTQ quality assessment

  • The ridge plot below shows per-base quality scores across read positions. Each x-axis position includes two ridges: forward reads (left) and reverse reads (right)
  • Interpretation: Forward reads have higher overall quality. Reverse read quality drops sharply around 157 bp, whereas forward reads remain consistently above a Phred score of 30

3.2 Adator trimming

  • Optional primer/adapter trimming using cutadapt
$ cutadapt \
  -g FORWARD_PRIMER_SEQ \
  -G REVERSE_PRIMER_SEQ \
  --discard-untrimmed \
  -o sample_R1.trimmed.fastq.gz \
  -p sample_R2.trimmed.fastq.gz \
  sample_R1.fastq.gz sample_R2.fastq.gz

3.3 Preparation in the R environment

  • Set the working directory to import FASTQ files and save all outputs generated in this report
# Do not run
base_dir <- "WORKING_DIRECTORY" # path to your project folder
setwd(base_dir)

3.4 Load R packages

  • Required packages are listed in Section 2
library(dada2) # ASV inference and DADA2 pipeline functions
library(Biostrings) # DNA/RNA sequence handling (FASTA I/O, string ops)
library(ShortRead) # FASTQ input and quality assessment utilities
library(data.table) # fast, memory-efficient tabular data manipulation
library(ggplot2) # static plotting with the grammar of graphics
library(patchwork) # combine multiple ggplot figures into layouts
library(RColorBrewer) # color palettes (e.g., for plots/heatmaps)
library(plotly) # interactive versions of plots (hover/zoom)
library(phyloseq) # microbiome data structures + analysis/visualization

3.5 Import FASTQ files

  • Enumerate R1 files in the FASTQ directory, derive unique sample IDs from filenames, and (if paired-end) validate that each sample has a matching R2 file
  • List FASTQ files, derive sample IDs, and validate paired-end matches
fastq_dir <- file.path(base_dir, "FASTQ", "raw")
r1_suffix <- "_R1.fastq.gz"
r2_suffix <- "_R2.fastq.gz"

r1_files <- sort(list.files(fastq_dir, pattern = paste0(r1_suffix, "$"), full.names = TRUE))
stop_if_not(length(r1_files) > 0, paste0("No R1 files matching '*", r1_suffix, "' found in: ", fastq_dir))

sample_ids <- vapply(r1_files, derive_sample_id_from_r1, character(1))
stop_if_not(!anyDuplicated(sample_ids), "Duplicate sample IDs derived from R1 filenames.")

names(r1_files) <- sample_ids

if (isTRUE(is_paired_end)) {
        r2_files <- file.path(fastq_dir, paste0(sample_ids, r2_suffix))
        missing_r2 <- !file.exists(r2_files)
        stop_if_not(
                !any(missing_r2),
                paste0("Missing R2 files for: ", paste(sample_ids[missing_r2], collapse = ", "))
        )
        names(r2_files) <- sample_ids
} else {
        r2_files <- character(0)
}

3.6 Read quality

3.6.1 Raw reads

  • Per-base quality profiles from the original demultiplexed FASTQs, before any trimming or filtering.
if (isTRUE(is_paired_end)) {
        qp_raw <- filter_qp_inputs(unname(r1_files), unname(r2_files))

        p_raw_R1 <- plotQualityProfile(qp_raw$R1, aggregate = TRUE) +
                labs(subtitle = "Read 1")

        p_raw_R2 <- plotQualityProfile(qp_raw$R2, aggregate = TRUE) +
                labs(subtitle = "Read 2")

        print(p_raw_R1 + p_raw_R2)
} else {
        p_raw_R1 <- plotQualityProfile(unname(r1_files), aggregate = TRUE)
        print(p_raw_R1)
}

3.6.2 After cutadapt

  • Quality profiles after cutadapt processing, showing read quality after primer/adaptor removal and any configured trimming.
if (isTRUE(do_cutadapt)) {
        cutadapt_dir <- base::file.path(base_dir, "FASTQ", "cutadapt")
        ca_r1 <- sort(list.files(cutadapt_dir, pattern = paste0(r1_suffix, "$"), full.names = TRUE))
        ca_ids <- vapply(ca_r1, derive_sample_id_from_r1, character(1))

        if (isTRUE(is_paired_end)) {
                ca_r2 <- file.path(cutadapt_dir, paste0(ca_ids, r2_suffix))
                stop_if_not(all(file.exists(ca_r2)), "Missing some cutadapt R2 files.")

                qp_afterqc <- filter_qp_inputs(ca_r1, ca_r2)

                p_afterqc_R1 <- plotQualityProfile(qp_afterqc$R1, aggregate = TRUE) +
                        labs(subtitle = "After trimming (cutadapt) — Read 1")

                p_afterqc_R2 <- plotQualityProfile(qp_afterqc$R2, aggregate = TRUE) +
                        labs(subtitle = "After trimming (cutadapt) — Read 2")

                print(p_afterqc_R1 + p_afterqc_R2)

                filt_in_r1 <- ca_r1
                filt_in_r2 <- ca_r2
        } else {
                qp_afterqc <- list(R1 = ca_r1, R2 = NULL)

                p_afterqc_R1 <- plotQualityProfile(qp_afterqc$R1, aggregate = TRUE) +
                        labs(subtitle = "After trimming (cutadapt) — Read 1")

                print(p_afterqc_R1)

                filt_in_r1 <- ca_r1
                filt_in_r2 <- NULL
        }
} else {
        filt_in_r1 <- unname(r1_files)
        filt_in_r2 <- if (isTRUE(is_paired_end)) unname(r2_files) else NULL
}

  • Compared with the raw reads, this checkpoint highlights how cutadapt affects:
    • The effective read length distribution (reads may become shorter after trimming)
    • The presence or reduction of low-quality tails (often improved if 3′ trimming is applied)

3.6.3 After filterAndTrim

  • Quality profiles after DADA2 filterAndTrim(), reflecting the reads retained for denoising after quality-based trimming and filtering.
filter_trim_dir <- file.path(out_dir, "filter_and_trim")
dir_create(filter_trim_dir)

filt_out_r1 <- file.path(filter_trim_dir, paste0(sample_ids, r1_suffix))
if (isTRUE(is_paired_end)) {
        filt_out_r2 <- file.path(filter_trim_dir, paste0(sample_ids, r2_suffix))
} else {
        filt_out_r2 <- NULL
}

if (isTRUE(is_paired_end)) {
        truncLen_vec <- c(as.integer(filt_truncLen_R1), as.integer(filt_truncLen_R2))
        trimLeft_vec <- c(as.integer(filt_trimLeft_R1), as.integer(filt_trimLeft_R2))
        maxEE_vec <- c(filt_maxEE_R1, filt_maxEE_R2)

        filt_stats <- filterAndTrim(
                fwd = filt_in_r1,
                filt = filt_out_r1,
                rev = filt_in_r2,
                filt.rev = filt_out_r2,
                truncLen = truncLen_vec,
                trimLeft = trimLeft_vec,
                maxN = filt_maxN,
                maxEE = maxEE_vec,
                truncQ = as.integer(filt_truncQ),
                rm.phix = isTRUE(filt_rm_phix),
                compress = isTRUE(filt_compress),
                multithread = isTRUE(multithread),
                matchIDs = isTRUE(filt_matchIDs)
        )
} else {
        filt_stats <- filterAndTrim(
                fwd = filt_in_r1,
                filt = filt_out_r1,
                truncLen = as.integer(filt_truncLen_R1),
                trimLeft = as.integer(filt_trimLeft_R1),
                maxN = filt_maxN,
                maxEE = filt_maxEE_R1,
                truncQ = as.integer(filt_truncQ),
                rm.phix = isTRUE(filt_rm_phix),
                compress = isTRUE(filt_compress),
                multithread = isTRUE(multithread)
        )
}

filt_dt <- as.data.table(filt_stats, keep.rownames = "sample_id")

if (isTRUE(is_paired_end)) {
        qp_after_filter <- filter_qp_inputs(filt_out_r1, filt_out_r2)

        p_filt_R1 <- plotQualityProfile(qp_after_filter$R1, aggregate = TRUE) +
                labs(subtitle = "After filterAndTrim — Read 1")

        p_filt_R2 <- plotQualityProfile(qp_after_filter$R2, aggregate = TRUE) +
                labs(subtitle = "After filterAndTrim — Read 2")

        print(p_filt_R1 + p_filt_R2)
} else {
        qp_after_filter <- list(R1 = filt_out_r1, R2 = NULL)

        p_filt_R1 <- plotQualityProfile(filt_out_r1, aggregate = TRUE) +
                labs(subtitle = "After filterAndTrim — Read 1")

        print(p_filt_R1)
}

  • These are the reads that will be used as input to denoising, so this checkpoint reflects what the algorithm actually sees.

3.7 Learn the error rates

  • Builds an empirical sequencing error model from the quality-filtered reads
  • DADA2 uses this model to distinguish true biological variants (ASVs) from sequencing errors during denoising
  • Visualization: The learned substitution error rates from learnErrors()
    • Each panel corresponds to a specific substitution type (e.g., A→C), showing how often one base is misread as another
    • Axes and elements:
      • X-axis: Phred quality score (Q). Higher Q means higher expected base-call accuracy
      • Y-axis: Estimated probability of that substitution error on a log scale
      • Points: Empirical error estimates derived from the observed data used to learn errors
      • Lines: The fitted error model that DADA2 will use during denoising
    • How to interpret a “good” plot:
      • Monotonic trend: Error rates should generally decrease as Q increases (higher quality, fewer errors)
      • Close agreement: Points and lines should be reasonably aligned, indicating the model fits the empirical signal
      • Reasonable magnitude: At high Q scores, error rates should be very low; at lower Q scores, they should be higher
if (isTRUE(is_paired_end)) {
        err_inputs <- exclude_negatives(qp_after_filter$R1, qp_after_filter$R2, neg_ids = neg_samples)

        errF <- learnErrors(err_inputs$R1, nbases = learn_nbases, multithread = isTRUE(multithread))
        errR <- learnErrors(err_inputs$R2, nbases = learn_nbases, multithread = isTRUE(multithread))

        p_errF <- plotErrors(errF, nominalQ = TRUE) + labs(subtitle = "Forward (Read 1)")
        p_errR <- plotErrors(errR, nominalQ = TRUE) + labs(subtitle = "Reverse (Read 2)")

        print(p_errF + p_errR)
} else {
        err_inputs <- exclude_negatives(qp_after_filter$R1, qp_after_filter$R1, neg_ids = neg_samples)
        err_inputs$R2 <- NULL

        errF <- learnErrors(err_inputs$R1, nbases = learn_nbases, multithread = isTRUE(multithread))
        errR <- NULL

        p_errF <- plotErrors(errF, nominalQ = TRUE) + labs(subtitle = "Forward (Read 1)")
        print(p_errF)
}
## Error learning inputs: R1 files = 330; R2 files = 330
## 102086104 total bases in 406899 reads from 37 samples will be used for learning the error rates.
## 101865066 total bases in 406899 reads from 37 samples will be used for learning the error rates.

3.8 Dereplication and denoising

  • Dereplication: compresses each sample into a set of unique sequences and counts, which reduces redundancy and preserves abundance information needed for inference.
    • Efficiency: operating on unique sequences (rather than all reads) substantially reduces runtime and memory requirements.
    • Accuracy: abundance-aware, error-model–based inference improves resolution beyond OTU clustering by separating closely related true variants from error-derived sequences.
  • Denoising (the primary DADA2 step): uses the learned error models to distinguish true biological variants from sequencing errors and outputs per-sample ASV counts.
pool_arg <- map_pooling_mode(dada_pool)

derepF <- derepFastq(qp_after_filter$R1, verbose = FALSE)
names(derepF) <- sub(paste0(r1_suffix, "$"), "", basename(qp_after_filter$R1))

if (isTRUE(is_paired_end)) {
        derepR <- derepFastq(qp_after_filter$R2, verbose = FALSE)
        names(derepR) <- sub(paste0(r2_suffix, "$"), "", basename(qp_after_filter$R2))
} else {
        derepR <- NULL
}

dadaF <- dada(derepF, err = errF, pool = pool_arg, multithread = isTRUE(multithread))

if (isTRUE(is_paired_end)) {
        dadaR <- dada(derepR, err = errR, pool = pool_arg, multithread = isTRUE(multithread))
} else {
        dadaR <- NULL
}

dadaF[[1]]
if (isTRUE(is_paired_end)) dadaR[[1]]
## dada-class: object describing DADA2 denoising results
## 119 sequence variants were inferred from 2848 input unique sequences.
## Key parameters: OMEGA_A = 1e-40, OMEGA_C = 1e-40, BAND_SIZE = 16
## dada-class: object describing DADA2 denoising results
## 100 sequence variants were inferred from 5217 input unique sequences.
## Key parameters: OMEGA_A = 1e-40, OMEGA_C = 1e-40, BAND_SIZE = 16

3.9 Merge paired reads

  • Combines denoised forward and reverse sequences within each sample by aligning their overlap
    • Produces a single reconstructed amplicon sequence per variant (when reads overlap sufficiently), reducing read-end errors by requiring consistency across the overlap
    • Applies merge criteria such as minimum overlap and allowed mismatches (if specified)
if (isTRUE(is_paired_end)) {
        merge_args <- list(dadaF = dadaF, derepF = derepF, dadaR = dadaR, derepR = derepR, verbose = TRUE)
        if (!is.null(merge_minOverlap)) merge_args$minOverlap <- as.integer(merge_minOverlap)
        if (!is.null(merge_maxMismatch)) merge_args$maxMismatch <- as.integer(merge_maxMismatch)

        mergers <- do.call(mergePairs, merge_args)
        seqtab <- makeSequenceTable(mergers)
} else {
        mergers <- NULL
        seqtab <- makeSequenceTable(dadaF)
}

asv_seqs <- colnames(seqtab)
asv_ids <- sprintf("ASV%03d", seq_along(asv_seqs))

asv_map_dt <- data.table::data.table(
        asv_id       = asv_ids,
        asv_sequence = asv_seqs,
        asv_length   = nchar(asv_seqs),
        total_count  = as.integer(colSums(seqtab))
)

# Inspect the matrix after replacing sequences in the column names
to_show <- seqtab
colnames(to_show) <- asv_ids
head(to_show[, c(1:5)])
##        ASV001 ASV002 ASV003 ASV004 ASV005
## F3D0      605    357    478    168    502
## F3D1      416    364     79    146     44
## F3D11    3302   1896    797    540      0
## F3D125   1110    676    767    476    852
## F3D13    2308   1870   1049   1225    306
## F3D141    462    384    543    199    354
# Inspect sequence table dimensions: (n_samples x n_ASVs)
dim(seqtab)
## [1] 330 420
# Inspect the first column name
colnames(seqtab)[1] # ASV001
## [1] "TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAAGATCAAGTCAGCGGTAAAATTGAGAGGCTCAACCTCTTCGAGCCGTTGAAACTGGTTTTCTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACTCCGATTGCGAAGGCAGCATACCGGCGCTCAACTGACGCTCATGCACGAAAGTGTGGGTATCGAACAGG"
# Inspect distribution of sequence lengths
table(nchar(getSequences(seqtab)))
## 
## 251 252 253 254 255 
##   1  77 329   9   4

3.10 Remove chimeras

  • Removes likely PCR chimeras (artificial sequences formed by recombination of two true templates during amplification) from the ASV table using removeBimeraDenovo()
  • This step reduces false-positive ASVs and improves downstream interpretation
seqtab_nochim <- removeBimeraDenovo(
        seqtab,
        method = chimera_method,
        multithread = isTRUE(multithread),
        verbose = TRUE
)
## Identified 66 bimeras out of 420 input sequences.

3.11 Read retention overview

3.11.1 Statistics tracking and export

  • Record the number of reads removed at each step and export stats with sample metadata
  • All exported files are available in the Downloads section below
filt_dt_clean <- copy(filt_dt)
filt_dt_clean[, sample_id := sub(paste0(r1_suffix, "$"), "", basename(sample_id))]
setkey(filt_dt_clean, sample_id)

track_dt <- data.table(
        sample_id  = names(dadaF),
        denoised_F = vapply(dadaF, getN, integer(1)),
        denoised_R = if (isTRUE(is_paired_end)) vapply(dadaR, getN, integer(1)) else NA_integer_,
        merged     = rowSums(seqtab, na.rm = TRUE),
        nonchim    = rowSums(seqtab_nochim, na.rm = TRUE)
)
track_dt <- merge(
        track_dt,
        filt_dt_clean[, .(sample_id, reads_in = reads.in, reads_filtered = reads.out)],
        by = "sample_id",
        all.x = TRUE
)
setcolorder(
        track_dt,
        c("sample_id", "reads_in", "reads_filtered", "denoised_F", "denoised_R", "merged", "nonchim")
)

track_dt <- as.data.table(track_dt)
track_dt[, denoised := if (isTRUE(is_paired_end)) pmin(denoised_F, denoised_R) else denoised_F]
track_dt[, sex := fifelse(
        grepl("^F", sample_id), "Female",
        fifelse(grepl("^M", sample_id), "Male", NA_character_)
)]
track_dt[, day := as.integer(sub(".*D", "", sample_id))]
track_dt[, stage := fifelse(
        day <= 50L, "Early",
        fifelse(day >= 100L, "Late", NA_character_)
)]
track_dt[, group := factor(
        paste(stage, sex, sep = " + "),
        levels = c("Early + Male", "Early + Female", "Late + Male", "Late + Female")
)]
track_dt[, pct_remaining_final := 100 * (nonchim / reads_in)]
head(track_dt)
## Key: <sample_id>
##    sample_id reads_in reads_filtered denoised_F denoised_R merged nonchim
##       <char>    <num>          <num>      <int>      <int>  <num>   <num>
## 1:      F3D0     7793           7733       7486       7094   6060    6060
## 2:      F3D1     5869           5829       5657       5453   5083    5083
## 3:     F3D11    17790          17670      17322      16105  14284   14089
## 4:    F3D125    12674          12609      12294      11471   9383    9340
## 5:     F3D13    17277          17172      16905      15613  13953   13676
## 6:    F3D141     5958           5926       5733       5302   4490    4490
##    denoised    sex   day  stage          group pct_remaining_final
##       <int> <char> <int> <char>         <fctr>               <num>
## 1:     7094 Female     0  Early Early + Female            77.76209
## 2:     5453 Female     1  Early Early + Female            86.60760
## 3:    16105 Female    11  Early Early + Female            79.19618
## 4:    11471 Female   125   Late  Late + Female            73.69418
## 5:    15613 Female    13  Early Early + Female            79.15726
## 6:     5302 Female   141   Late  Late + Female            75.36086

3.11.2 Mean read retention summary

  • Mean read retention from raw input to the final non-chimeric ASV table, reported as percent retained versus excluded across all samples
mean_remaining <- mean(track_dt$pct_remaining_final, na.rm = TRUE)
mean_excluded <- 100 - mean_remaining

bar1_dt <- data.table(
        label  = "Raw to final",
        status = factor(c("Remaining", "Excluded"), levels = c("Remaining", "Excluded")),
        pct    = c(mean_remaining, mean_excluded)
)

ggplot(bar1_dt, aes(x = label, y = pct, fill = status)) +
        geom_col(width = 0.6) +
        coord_flip() +
        geom_text(
                aes(label = sprintf("%.1f%%", pct)),
                position = position_stack(vjust = 0.5),
                size = 4
        ) +
        scale_fill_manual(values = c("Remaining" = "steelblue", "Excluded" = "grey60")) +
        scale_y_continuous(limits = c(0, 100), expand = expansion(mult = c(0, 0.02))) +
        labs(
                title = NULL,
                x = NULL,
                y = "Percentage of reads",
                fill = NULL
        ) +
        theme_classic(base_size = 12) +
        theme(
                legend.position = "bottom",
                text = element_text(size = 12)
        )

3.11.3 Read retention by time and group

  • Mean remaining reads at each major checkpoint, summarized across the four groups (Early/Late × Female/Male) to highlight where reads are primarily lost and whether retention differs by group.
steps_to_plot <- c("reads_in", "reads_filtered", "denoised", "merged", "nonchim")
step_labels <- c(
        reads_in       = "Raw reads",
        reads_filtered = "After filterAndTrim",
        denoised       = "After denoising",
        merged         = "After merging pairs",
        nonchim        = "After chimera removal"
)

plot_long <- melt(
        track_dt[, c("sample_id", "group", steps_to_plot), with = FALSE],
        id.vars = c("sample_id", "group"),
        variable.name = "step",
        value.name = "remaining_reads"
)
plot_long[, step := factor(step, levels = steps_to_plot, labels = unname(step_labels[steps_to_plot]))]

sum_dt <- plot_long[, .(remaining_reads = mean(remaining_reads, na.rm = TRUE)), by = .(step, group)]
y_max <- max(sum_dt$remaining_reads, na.rm = TRUE)

step_cols <- brewer.pal(n = 5, name = "Dark2")
names(step_cols) <- levels(sum_dt$step)

ggplot(sum_dt, aes(x = step, y = remaining_reads, fill = step)) +
        geom_col(width = 0.75) +
        facet_wrap(~group, ncol = 2, scales = "fixed") +
        scale_y_continuous(
                limits = c(0, y_max),
                expand = expansion(mult = c(0, 0.05))
        ) +
        scale_fill_manual(values = step_cols) +
        labs(
                title = NULL,
                x = NULL,
                y = "Remaining reads (mean within group)",
                fill = NULL
        ) +
        theme_classic(base_size = 12) +
        theme(
                legend.position = "bottom",
                text = element_text(size = 12),
                axis.text.x = element_blank(),
                axis.ticks.x = element_blank()
        )

3.12 ASV composition snapshot

3.12.1 ASV prevalence and abundance

  • Core: All remaining ASVs outside the low-abundance/low-prevalence region. These are comparatively well-supported variants detected in more samples and/or at higher total counts, and therefore most strongly influence downstream community summaries.
  • Intermediate: ASVs in the lowest 10% of both abundance and prevalence, excluding the “Rare” set. These are low-to-moderate support variants that occur in a limited subset of samples and may reflect condition-specific taxa, low-level carryover, or biologically uncommon members.
  • Rare: ASVs in the lowest 5% of both total abundance (summed counts across all samples) and prevalence (number of samples detected). These represent low-support, sparsely observed variants that contribute minimally to the overall read pool.
n_samples <- nrow(seqtab_nochim)
n_asvs <- ncol(seqtab_nochim)

prev_abund_dt <- data.table(
        asv_sequence = colnames(seqtab_nochim),
        abundance_total_count = as.integer(colSums(seqtab_nochim)),
        prevalence_n_samples = as.integer(colSums(seqtab_nochim >= presence_threshold))
)

asv_map_sub <- unique(asv_map_dt[, .(asv_id, asv_sequence, asv_length)])
setkey(asv_map_sub, asv_sequence)
setkey(prev_abund_dt, asv_sequence)
prev_abund_dt <- asv_map_sub[prev_abund_dt]

prevalence_cutoff_rare <- as.numeric(quantile(
        prev_abund_dt$prevalence_n_samples,
        probs = p_rare, na.rm = TRUE, type = 7
))
prevalence_cutoff_intermediate <- as.numeric(quantile(
        prev_abund_dt$prevalence_n_samples,
        probs = p_intermediate, na.rm = TRUE, type = 7
))
abundance_cutoff_rare <- as.numeric(quantile(
        prev_abund_dt$abundance_total_count,
        probs = p_rare, na.rm = TRUE, type = 7
))
abundance_cutoff_intermediate <- as.numeric(quantile(
        prev_abund_dt$abundance_total_count,
        probs = p_intermediate, na.rm = TRUE, type = 7
))

prevalence_cutoff_rare_i <- floor(prevalence_cutoff_rare)
prevalence_cutoff_intermediate_i <- floor(prevalence_cutoff_intermediate)
abundance_cutoff_rare_i <- floor(abundance_cutoff_rare)
abundance_cutoff_intermediate_i <- floor(abundance_cutoff_intermediate)

prev_abund_dt[, class := "Core"]
prev_abund_dt[
        prevalence_n_samples <= prevalence_cutoff_intermediate_i &
                abundance_total_count <= abundance_cutoff_intermediate_i,
        class := "Intermediate"
]
prev_abund_dt[
        prevalence_n_samples <= prevalence_cutoff_rare_i &
                abundance_total_count <= abundance_cutoff_rare_i,
        class := "Rare"
]
prev_abund_dt[, class := factor(class, levels = c("Rare", "Intermediate", "Core"))]

n_rare <- sum(prev_abund_dt$class == "Rare")
n_int <- sum(prev_abund_dt$class == "Intermediate")
n_core <- sum(prev_abund_dt$class == "Core")

summary_sentence <- sprintf(
        "Total ASVs: %d in %d samples. Rare: %d; Intermediate: %d; Core: %d",
        n_asvs, n_samples, n_rare, n_int, n_core
)

sample_ids <- rownames(seqtab_nochim)
top_sample_str <- vapply(seq_len(ncol(seqtab_nochim)), function(j) {
        col <- seqtab_nochim[, j]
        idx <- which(col > 0)
        if (length(idx) == 0) {
                return("None (ASV not observed)")
        }
        ord <- idx[order(col[idx], decreasing = TRUE)]
        ord <- ord[seq_len(min(length(ord), top_samples_in_hover))]
        paste0(sample_ids[ord], " (", as.integer(col[ord]), ")", collapse = "; ")
}, character(1))
prev_abund_dt[, top_samples := top_sample_str]

prev_abund_dt[, hover := paste0(
        "ASV: ", asv_id,
        "<br>Class: ", as.character(class),
        "<br>Abundance (total count): ", abundance_total_count,
        "<br>Prevalence (n samples): ", prevalence_n_samples,
        "<br>ASV length (bp): ", ifelse(is.na(asv_length), "NA", as.character(asv_length)),
        "<br>Top sample(s): ", top_samples
)]

color_map <- c("Rare" = "grey60", "Intermediate" = "goldenrod2", "Core" = "dodgerblue3")

p_prev_abund <- plot_ly(
        data = prev_abund_dt,
        x = ~abundance_total_count,
        y = ~prevalence_n_samples,
        type = "scatter",
        mode = "markers",
        color = ~class,
        colors = color_map,
        text = ~hover,
        hoverinfo = "text"
) |>
        layout(
                title = list(text = summary_sentence),
                xaxis = list(title = "Abundance (total count; log10)", type = "log"),
                yaxis = list(title = "Prevalence (number of samples)", rangemode = "tozero"),
                legend = list(
                        orientation = "h",
                        x = 0.5, xanchor = "center",
                        y = -0.1, yanchor = "top"
                ),
                hoverlabel = list(align = "left")
        )

p_prev_abund

3.12.2 ASV length distribution

  • Two complementary views:
    • (left) Histogram of ASV lengths (counts of ASVs per length)
    • (right) Abundance-weighted histogram (sum of total_count per length)
len_counts_dt <- asv_map_dt[, .(n_asvs = .N), by = .(asv_length)]
setorder(len_counts_dt, asv_length)

p_len_count <- ggplot(len_counts_dt, aes(x = asv_length, y = n_asvs)) +
        geom_col() +
        labs(
                title = NULL,
                x = "ASV length (bp)",
                y = "Number of ASVs"
        ) +
        theme_classic(base_size = 12)

len_abund_dt <- asv_map_dt[, .(total_reads = sum(as.integer(total_count), na.rm = TRUE)), by = .(asv_length)]
setorder(len_abund_dt, asv_length)

p_len_abund <- ggplot(len_abund_dt, aes(x = asv_length, y = total_reads)) +
        geom_col() +
        scale_y_log10() +
        labs(
                title = NULL,
                x = "ASV length (bp)",
                y = "Total reads assigned to ASVs (log10)"
        ) +
        theme_classic(base_size = 12)

print(p_len_count + p_len_abund)

4 Taxonomy assignment

  • DADA2 will serve as the primary method because it denoises amplicon reads into high-confidence ASVs and removes artifacts (e.g., sequencing errors and chimeras)
  • VSEARCH will be used as a complementary step to provide post hoc, reference-based confirmation and annotation of representative ASV sequences against curated databases

4.1 DADA2’s taxonomy assignment

  • The DADA2 function assignTaxonomy() provides a built-in implementation of the naïve Bayesian classifier for taxonomic assignment
  • Multiple reference DBs were used to assign taxonomy to ASVs; the below shows an example using SILVA, while taxonomy assignments from the other databases are provided in the Download section
  • DADA2-formatted training fasta file was downloaded from Taxonomic reference data
    • SILVA: Broad coverage across Bacteria, Archaea, and Eukaryota (SSU rRNA (16S/18S) and LSU rRNA)
    • RDP: rRNA sequences plus the RDP Classifier ecosystem (16S (Bacteria/Archaea) and fungal 28S)
    • GreenGenes2: Unifies 16S and genomic data in one reference tree (16S integrated with genome phylogeny)
# Set the file paths to your taxonomy reference files
tax_train_fasta <- "path/to/trainset.fa"
tax_species_fasta <- "path/to/assignSpecies.fa"
tax_mat <- dada2::assignTaxonomy(
        seqtab_nochim,
        refFasta = tax_train_fasta,
        multithrea = isTRUE(multithread),
        tryRC = TRUE
)

tax_mat <- dada2::addSpecies(tax_mat, refFasta = tax_species_fasta, allowMultiple = TRUE)

to_show <- tax_mat # Removing sequence rownames for display only
rownames(to_show) <- NULL
head(to_show)
##      Kingdom    Phylum         Class         Order           Family          
## [1,] "Bacteria" "Bacteroidota" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [2,] "Bacteria" "Bacteroidota" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [3,] "Bacteria" "Bacteroidota" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [4,] "Bacteria" "Bacteroidota" "Bacteroidia" "Bacteroidales" "Bacteroidaceae"
## [5,] "Bacteria" "Bacteroidota" "Bacteroidia" "Bacteroidales" "Muribaculaceae"
## [6,] "Bacteria" "Bacteroidota" "Bacteroidia" "Bacteroidales" "Rikenellaceae" 
##      Genus         Species                  
## [1,] NA            NA                       
## [2,] NA            NA                       
## [3,] NA            NA                       
## [4,] "Bacteroides" "acidifaciens/caecimuris"
## [5,] NA            NA                       
## [6,] "Alistipes"   NA

4.2 GTDB-based annotation with VSEARCH

  • Runs a GTDB reference search by matching DADA2 ASV sequences to the GTDB database with VSEARCH
  • Adds GTDB hits to the ASV annotation table and exports unmatched ASVs to a separate FASTA file

4.2.1 Run VSEARCH

  • VSEARCH (macOS; v2.30.1) was installed via Homebrew and executed from the terminal:
$ vsearch --usearch_global asv_sequences.fasta \
  --db GTDB_bac120_arc53_ssu_r220_fullTaxo.fa \
  --notrunclabels \
  --userout Vsearch_GTDB_selected.tsv \
  --userfields query+target+id \
  --uc Vsearch_GTDB_raw.uc \
  --id 0.9 \
  --iddef 0 \
  --maxaccepts 30 \
  --top_hits_only \
  --strand both \
  --threads 1 \
  --log log.txt

4.2.2 Summarize GTDB hits

  • GTDB hits were merged with ASV metadata to generate an annotated results table, available in the Download section below
$ head Vsearch_GTDB_hits.tsv 
asv_id  asv_seq asv_length  total_count gtdb_hit    identity
ASV001  TACGGAGGATGCGAGCGTTATCCGGA...   252 278298  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;Duncaniella;Duncaniella_muris(RS_GCF_003024805_1 100
ASV002  TACGGAGGATGCGAGCGTTATCCGGA...   252 237358  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;Duncaniella;Duncaniella_freteri(RS_GCF_004766125_1   95.2
ASV003  TACGGAGGATGCGAGCGTTATCCGGA...   252 198254  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;UBA7173;UBA7173_sp013316675(GB_GCA_910575545_1   93.7
ASV004  TACGGAGGATCCGAGCGTTATCCGGA...   253 168783  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Bacteroidaceae;Bacteroides;Bacteroides_caecimuris(RS_GCF_001688725_2    100
ASV005  TACGGAGGATGCGAGCGTTATCCGGA...   252 141946  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;UBA7173;UBA7173_sp001689685(GB_GCA_910575615_1   99.6
ASV006  TACGGAGGATTCAAGCGTTATCCGGA...   253 110922  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Rikenellaceae;Alistipes;Alistipes_sp003979135(GB_GCA_948603215_1    100
ASV007  TACGGAGGATGCGAGCGTTATCCGGA...   252 102123  Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;JAGBWK01;JAGBWK01_sp004102805(GB_GCA_004102805_1 96.8
ASV008  TACGGAGGATGCGAGCGTTATCCGGA...   252 98814   Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;Paramuribaculum;Paramuribaculum_sp001689565(GB_GCA_003762715_1   97.2
ASV009  TACGGAGGATGCGAGCGTTATCCGGA...   252 95637   Bacteria;Bacteroidota;Bacteroidia;Bacteroidales;Muribaculaceae;JAGBWK01;JAGBWK01_sp004102805(GB_GCA_004102805_1 95.6

5 Analysis

  • The phyloseq R package provides a robust framework for downstream microbiome analysis and visualization, and the scripts used here were adapted from the phyloseq tutorial
  • Results and visualizations are reported based on SILVA for consistency; however, taxonomy assignments from the other databases may be loaded to reproduce the same workflow using the scripts provided below

5.1 Format conversion

  • First, the DADA2 output object (i.e., seqtab_nochim) needs to be converted into a phyloseq object.
sample_ids <- rownames(seqtab_nochim)
subject_raw <- sapply(strsplit(sample_ids, "D"), `[`, 1)
sex <- substr(subject_raw, 1, 1)
day <- as.integer(sapply(strsplit(sample_ids, "D"), `[`, 2))

sam_df <- data.frame(
        Subject = sample_ids,
        Sex = factor(sex, levels = c("M", "F")),
        Day = day
)
sam_df$Group <- factor(ifelse(sam_df$Day > 100, "Late", "Early"),
        levels = c("Early", "Late"),
        labels = c("E", "L")
)
sam_df$Category <- factor(paste0(sam_df$Group, "_", sam_df$Sex),
        levels = c("E_M", "E_F", "L_M", "L_F")
)
rownames(sam_df) <- sample_ids

ps <- phyloseq(
        otu_table(seqtab_nochim, taxa_are_rows = FALSE),
        sample_data(sam_df),
        tax_table(tax_mat)
)

dna <- DNAStringSet(taxa_names(ps))
names(dna) <- taxa_names(ps)
ps <- merge_phyloseq(ps, dna)
taxa_names(ps) <- sprintf("ASV%03d", seq(ntaxa(ps)))
ps
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 354 taxa and 330 samples ]
## sample_data() Sample Data:       [ 330 samples by 5 sample variables ]
## tax_table()   Taxonomy Table:    [ 354 taxa by 7 taxonomic ranks ]
## refseq()      DNAStringSet:      [ 354 reference sequences ]

5.2 Alpha diversity over time

  • Visualize within-sample diversity using Shannon and Simpson indices across sampling Day, with points colored by Group (Early/Late) and shaped by Sex (Male/Female)

5.2.1 Group highlighted by color

plot_richness(ps,
        x = "Day", measures = c("Shannon", "Simpson"),
        color = "Group", shape = "Sex"
) +
        theme_bw() +
        scale_color_manual(values = group_cols) +
        geom_point(size = 3)

5.2.2 Sex highlighted by color

plot_richness(ps,
        x = "Day", measures = c("Shannon", "Simpson"),
        shape = "Group", color = "Sex"
) +
        theme_bw() +
        scale_color_manual(values = sex_cols) +
        geom_point(size = 3)

5.3 Beta diversity

5.3.1 Non-metric Multidimensional Scaling

  • Assess between-sample community differences using Bray–Curtis distances on relative-abundance data and visualize them with NMDS, with points colored by Group (Early/Late) and shaped by Sex (Male/Female)
ps_nz <- prune_samples(sample_sums(ps) > 0, ps)
otu <- as(otu_table(ps_nz), "matrix")
if (taxa_are_rows(ps_nz)) otu <- t(otu)
otu[!is.finite(otu)] <- 0
otu_table(ps_nz) <- otu_table(otu, taxa_are_rows = FALSE)

ps_prop <- transform_sample_counts(ps_nz, function(x) x / sum(x))
nmds_bray <- ordinate(ps_prop, method = "NMDS", distance = "bray", trace = 0)
p_ordi <- plot_ordination(ps_prop, nmds_bray, color = "Group", shape = "Sex") +
        geom_point(
                aes(
                        text = paste0(
                                "Subject: ", Subject,
                                "<br>Group: ", Group,
                                "<br>Sex: ", Sex
                        )
                ),
                size = 3
        ) +
        theme_bw() +
        scale_color_manual(values = group_cols)

ggplotly(p_ordi, tooltip = "text")

5.3.2 Bray–Curtis distance heatmap

  • Compute Bray–Curtis sample-to-sample distances and visualize them as a PCoA-ordered heatmap, with samples labeled and ordered by Day and annotated by Category (Group × Sex)
p_hm <- plot_heatmap(
        ps_nz,
        distance = "bray",
        method = "PCoA",
        sample.label = "Subject",
        sample.order = "Subject",
        sample.color = "Category"
) +
        scale_fill_viridis_c(option = "C") +
        guides(
                fill = guide_colorbar(
                        barwidth = unit(10, "cm"),
                        barheight = unit(0.35, "cm"),
                        title.position = "top"
                ),
                colour = guide_legend(nrow = 2, byrow = TRUE)
        ) +
        theme(
                legend.position = "bottom",
                legend.box = "vertical",
                legend.text = element_text(size = 9),
                legend.title = element_text(size = 9),
                legend.spacing.x = unit(0.3, "cm"),
                axis.text.x = element_text(angle = 90, vjust = 0.5, hjust = 1),
                axis.text.y = element_text(size = 9)
        )
p_hm

5.4 Taxonomic relative abundance

  • Plot the top 20 most abundant ASVs as relative abundance bar charts, aggregated and colored by Taxa, and faceted by Group (Early/Late) and Sex (Male/Female) across sampling days
top <- names(sort(taxa_sums(ps), decreasing = TRUE))[1:20]

ps_top <- transform_sample_counts(ps, function(OTU) OTU / sum(OTU))
ps_top <- prune_taxa(top, ps_top)

df_plot <- psmelt(ps_top)
df_plot$Family <- as.character(df_plot$Family)
df_plot$Family[is.na(df_plot$Family) | df_plot$Family == ""] <- "Unassigned"

dt <- as.data.table(df_plot)
dt_sum <- dt[, .(Abundance = mean(Abundance, na.rm = TRUE)), by = .(Category, Family)]
dt_sum[, Abundance := Abundance / sum(Abundance), by = Category]

ggplot(dt_sum, aes(x = Category, y = Abundance, fill = Family)) +
        geom_col(color = NA) +
        scale_y_continuous(limits = c(0, 1), labels = scales::percent) +
        scale_fill_brewer(palette = "Set2", drop = FALSE) +
        theme_bw() +
        theme(
                legend.position = "bottom",
                axis.text.x = element_text(angle = 90, vjust = 0, hjust = 1)
        ) +
        coord_flip()

5.5 Taxonomic lineage profiles by category

  • Taxonomic composition is summarized as lineage-level flows from higher to lower ranks for each category, enabling rapid comparison of dominant clades and where group-specific differences emerge along the taxonomic hierarchy
  • Click an image to view an enlarged version

Sex Early Late

Male
Female

6 Download

6.1 Preprocessing

  • read_tracking.tsv: Per-sample read count tracking table showing how many reads remain at each pipeline step
  • seqtab_asv_ids.tsv: ASV count table with samples as rows and ASV IDs as columns
  • asv_id_map.tsv: Tab-delimited mapping of ASV IDs to their corresponding DNA sequences
  • asv_sequences.fasta: FASTA file containing all unique ASV sequences (one record per ASV)
  • seqtab_raw.rds: R object for reproducibility and reloading without re-running earlier steps

6.2 Taxonomy classification

7 Research reproducibility

7.1 Parameters used in this analysis

Parameter Description This analysis Default
filt_truncLen_R1 Truncate reads to a fixed length 0 0
filt_trimLeft_R1 Remove a fixed number of bases from the 5′ end 0 0
filt_truncQ Truncate reads at the first position with quality score ≤ this threshold 2 2
filt_maxEE_R1 Discard reads with expected errors exceeding this threshold Inf Inf
filt_maxN Discard reads with more than this number of ambiguous bases (N) 0 0
filt_rm_phix Remove reads matching PhiX if present TRUE TRUE
learn_nbases Number of bases used to learn the error model 1e+08 1e+08
dada_pool Pooling strategy for sample inference none none
chimera_method Chimera removal approach used during ASV inference consensus consensus

7.2 Session info

## ─ Session info ───────────────────────────────────────────────────────────────────────────────────────
##  setting  value
##  version  R version 4.5.1 (2025-06-13)
##  os       macOS Tahoe 26.2
##  system   aarch64, darwin20
##  ui       X11
##  language (EN)
##  collate  en_CA.UTF-8
##  ctype    en_CA.UTF-8
##  tz       America/Edmonton
##  date     2026-01-18
## 
## ─ Packages ───────────────────────────────────────────────────────────────────────────────────────────
##  package              * version date (UTC) lib source
##  Biobase              * 2.68.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  BiocGenerics         * 0.54.1  2025-10-09 [1] Bioconductor 3.21 (R 4.5.1)
##  BiocParallel         * 1.42.2  2025-09-11 [1] Bioconductor 3.21 (R 4.5.1)
##  Biostrings           * 2.76.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  dada2                * 1.36.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  data.table           * 1.18.0  2025-12-24 [1] CRAN (R 4.5.2)
##  generics             * 0.1.4   2025-05-09 [1] CRAN (R 4.5.0)
##  GenomeInfoDb         * 1.44.3  2025-09-18 [1] Bioconductor 3.21 (R 4.5.1)
##  GenomicAlignments    * 1.44.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  GenomicRanges        * 1.60.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  ggplot2              * 4.0.1   2025-11-14 [1] CRAN (R 4.5.2)
##  IRanges              * 2.42.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  MatrixGenerics       * 1.20.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  matrixStats          * 1.5.0   2025-01-07 [1] CRAN (R 4.5.0)
##  patchwork            * 1.3.2   2025-08-25 [1] CRAN (R 4.5.0)
##  phyloseq             * 1.52.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.1)
##  plotly               * 4.11.0  2025-06-19 [1] CRAN (R 4.5.0)
##  RColorBrewer         * 1.1-3   2022-04-03 [1] CRAN (R 4.5.0)
##  Rcpp                 * 1.1.0   2025-07-02 [1] CRAN (R 4.5.0)
##  Rsamtools            * 2.24.1  2025-09-04 [1] Bioconductor 3.21 (R 4.5.1)
##  S4Vectors            * 0.46.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  ShortRead            * 1.66.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
##  SummarizedExperiment * 1.38.1  2025-04-28 [1] Bioconductor 3.21 (R 4.5.0)
##  XVector              * 0.48.0  2025-04-15 [1] Bioconductor 3.21 (R 4.5.0)
## 
##  [1] /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library
##  * ── Packages attached to the search path.
## 
## ──────────────────────────────────────────────────────────────────────────────────────────────────────